Soal: Pilihlah jawaban yang benar dari alternatif-alternatif yang diberikan : Arahan : Baca urutan nukleotida pada segmen mRNA yang diberikan dan urutan asam amino masing-masing pada rantai polipeptida untuk menjawab Q. no. 65 dan 66. mRNA → AUGUUUAUGCCUGUUUCUUAA Polipeptida Met-Phe-Met-Pro-Val-Ser Kodon mana yang masing-masing mengkode asam amino prolin dan valin dalam rantai polipeptida yang diberikan ?

Kodon adalah urutan tiga nukleotida pada untai mRNA yang mengkode asam amino tertentu.

Enam puluh empat kombinasi tiga nukleotida (kodon) yang berbeda dapat dibuat menggunakan empat nukleotida dalam mRNA (43 = 64 kombinasi).

Berikut ini adalah kodon yang mewakili Valin dan prolin masing-masing.

Valin: GUA, GUC, GUG, GUU

prolin: CCT, CCC, CCA, CCG

Jadi jawabannya adalah ‘ CCU dan GUU’.

Soal: Pilihlah jawaban yang benar dari alternatif-alternatif yang diberikan : Arahan : Baca urutan nukleotida pada segmen mRNA yang diberikan dan urutan asam amino masing-masing pada rantai polipeptida untuk menjawab Q. no. 65 dan 66. mRNA → AUGUUUAUGCCUGUUUCUUAA Polipeptida Met-Phe-Met-Pro-Val-Ser Kodon mana yang masing-masing mengkode asam amino prolin dan valin dalam rantai polipeptida yang diberikan ?

A» CCU dan GUU

B» GUU dan UCU

C» UCU dan UAA

D» GUU dan CCU

Tahapan Metamorfosis semut, kupu kupu dan katak
Contoh Ekologi: Tujuan, jenis, peranan, cabang
10 Ciri-ciri Nematoda yang penting berikut ini
Siklus hidup Bakteriofag: Pengertian, struktur, terapi